As either thunk and msw have pointed out, more suitable tools are available for this kind of task but here you have a script that can teach you something about how to handle it with awk
:
Content of script.awk:
## Process first file from arguments.
FNR == NR {
## Save ID and the range of characters to remove from sequence.
blast[ $1 ] = $(NF-1) " " $NF
next
}
## Process second file. For each FASTA id...
$1 ~ /^>/ {
## Get number.
id = substr( $1, 2 )
## Read next line (the sequence).
getline sequence
## if the ID is one found in the other file, get ranges and
## extract those characters from sequence.
if ( id in blast ) {
split( blast[id], ranges )
sequence = substr( sequence, 1, ranges[1] - 1 ) substr( sequence, ranges[2] + 1 )
## Print both lines with the shortened sequence.
printf "%s\n%s\n", $0, sequence
}
}
Assuming your 1.blasta
of the question and a customized 1.fasta
to test it:
>1
TCGACTAGCTACGACTCGGACTGACGAGCTACGACTACGG
>2
GCATCTGGGCTACGGGATCAGCTAGGCGATGCGAC
>27620
TTTGCGAGCGCGAAGCGACGACGAGCAGCAGCGACTCTAGCTACTGTTTGCGA
Run the script like:
awk -f script.awk 1.blast 1.fasta
That yields:
>1
ACTAGCTACGACTCGGACTGACGAGCTACGACTACGG
>27620
TTTGCGA
Of course I'm assumming some things, the most important that fasta sequences are not longer than one line.